NEBExpress MBP Fusion and Purification System E8201 manual

INSTRUCTION MANUAL

NEBExpress

MBP Fusion and Purification System

NEB #E8201S 1 set

Version 2.0_1/21

Table of Contents

Quick Start Guide ................................................................................................................................................................................ 2

Introduction ......................................................................................................................................................................................... 3

Construction of the Fusion Plasmid .................................................................................................................................................... 4

Subcloning Strategies .......................................................................................................................................................................... 4

Preparing a PCR Fragment for Cloning .............................................................................................................................................. 4

NEBuilder

Assembly of a PCR Fragment ......................................................................................................................................... 5

Transformation Protocol ...................................................................................................................................................................... 5

Affinity Chromatography .................................................................................................................................................................... 6

Regenerating the Amylose Resin Column .......................................................................................................................................... 8

Cleavage of the Fusion Protein ........................................................................................................................................................... 8

Denaturing the Fusion Protein for Improved TEV Protease Cleavage ............................................................................................... 8

Separating the Protein of Interest from MBP after TEV Protease Cleavage ...................................................................................... 9

Pilot Experiment ................................................................................................................................................................................ 10

Appendices

Appendix A: Media and Solutions .................................................................................................................................................... 11

Appendix B: Western Protocol .......................................................................................................................................................... 11

Appendix C: Troubleshooting and Tips ............................................................................................................................................ 12

Molecular Weights of pMAL Proteins .............................................................................................................................................. 17

References ........................................................................................................................................................................................ 17

Kit Components ................................................................................................................................................................................. 17

Revision History ............................................................................................................................................................................... 18

The NEBExpress MBP Fusion and Purification System Includes

The Amylose Resin should be stored at 4°C and all other reagents should be stored at –20°C.

pMAL-c6T Vector (200 µg/ml)

His-tagged vector. Supplied in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5.

Amylose Resin (50% v/v)

Supplied pre-swollen in 20% ethanol. Binding capacity > 4 mg/ml bed volume.

TEV Protease (10,000 U/ml)

Cloned from Tobacco Etch Virus and expressed in E. coli. 1 unit of TEV Protease will cleave 2 µg of MBP-fusion protein,

MBP6-TEV-Paramyosin ΔSal, to 95% completion in 1 hour at 30°C. Supplied in 50 mM Tris-HCl, 250 mM NaCl, 1 mM

TCEP, 1 mM EDTA, 50% glycerol, pH 7.5.

TEV Protease Reaction Buffer (10X)

500 mM Tris-HCl, 5 mM EDTA, 10 mM DTT, pH 7.5. Dilute to 1X in TEV Protease reactions.

Anti-MBP Monoclonal Antibody

A murine anti-maltose binding protein antibody, isotope IgG2a. Suggested dilution for Western blotting or ELISA 1:10,000.

MBP6 Protein (40 µg/ml)

Expressed from pMAL-c6T vector, including an N-terminal hexahistidine tag and amino acid residues coded for by the

polylinker up to the HindIII site. MW 45,519 daltons. Supplied in SDS-PAGE Sample Buffer.

MBP6-TEV-Paramyosin

Sal (5 mg/ml)

An MBP fusion protein used as a positive control for TEV Protease cleavage. Supplied in 20 mM Tris-HCl, 50 mM NaCl,

1 mM EDTA, 50% glycerol, pH 7.5. MW 70,103 daltons.

E. coli NEB Express (not competent)

fhuA2 [lon] ompT gal sulA11 R(mcr-73::miniTn10--TetS)2 [dcm] R(zgb-210::Tn10--TetS) endA1 Δ(mcrC-mrr)114::IS10.

Supplied in 50% glycerol. Store short term at –20°C. Store long term (> 30 days) at –80°C.

Quick Start Guide

1. Subclone the gene of interest into the pMAL-c6T vector.

2. Grow cells containing the pMAL-c6T fusion plasmid in LB containing ampicillin and 0.2% glucose to an A

600

of ~0.5.

3. Induce by adding IPTG to a final concentration of 0.3 mM.

4. Grow for an additional 2 hours at 37°C, or 4 hours at 30°C, or 6–8 hours at room temperature, or overnight at 12–16°C.

5. Harvest the cells and either freeze immediately or resuspend in 25 ml column buffer (CB) per liter of culture (CB, p. 11).

6. Lyse the cells by freeze-thaw followed by sonication.

7. Clarify the lysate by centrifugation at 20,000 x g for 20 minutes.

8. Dilute the supernatant (crude extract) by adding 125 ml cold CB for every 25 ml crude extract.

9. Load the diluted crude extract on a 15 ml amylose column.

10. Wash the column with ≥ 12 column volumes of CB.

11. Elute the fusion protein with CB containing 10 mM maltose.

Introduction

The pMAL-c6T vector (Figure 1) provides a method for expressing and purifying a protein produced from a cloned gene or open reading

frame. The cloned gene is inserted downstream from the malE gene of E. coli, which encodes maltose-binding protein (MBP), resulting in

the expression of an MBP fusion protein (1,2). The MBP in these vectors has been engineered for tighter binding to amylose. The method

uses the strong “tac” promoter and the malE translation initiation signals to give high-level expression of the cloned sequences (3,4), and a

one-step purification of the fusion protein using MBP’s affinity for maltose (5). The vector expresses the N-terminal hexahistidine tagged

malE gene (lacking its secretory signal sequence) followed by a multiple cloning site containing a TEV protease recognition sequence and

stop codons in all three frames. The pMAL-c6T vector expresses the MBP fusion in the cytoplasm.

Figure 1. pMAL-c6T vector.

pMAL- c6T (5,247 bp) has an exact deletion of the malE signal sequence. Arrows indicate the direction of transcription. Unique restriction

sites in the multiple cloning site (MCS) are indicated.

The vectors carry the lacIq gene, which codes for the Lac repressor. This keeps expression from Ptac low in the absence of IPTG induction.

The pMAL-c6T vector also include a sequence coding for the TEV Protease recognition site, located just 5´ to the polylinker insertion

sites. This allows MBP to be cleaved from the protein of interest after purification. TEV Protease cleaves after its six amino acid

recognition sequence, so that few or no vector-derived residues are attached to the protein of interest, depending on the site used for

cloning. In most cases, fusion protein expressed from pMAL-c6T constitutes 20–40% of the total cellular protein. For pMAL-c6T, a band

corresponding to the fusion protein can usually be seen by analyzing a small sample of induced cells by SDS-PAGE. The yield of fusion

protein from the affinity purification ranges up to 200 mg/liter culture, with typical yields in the range of 10–40 mg/liter. The yield varies

greatly depending upon the sequences fused to malE. Greater than 75% of the fusions made so far have worked in the affinity purification.

In the cases that have not worked, the fusion binds to the column poorly or not at all, is degraded by E. coli proteases, or is insoluble.

Construction of the Fusion Plasmid

To produce a fusion protein in the pMAL-c6T vector, the gene or open reading frame of interest must be inserted into the pMAL-c6T

vector so that it is in the same translational reading frame as the vector’s malE gene. The vector has a multiple cloning site (MCS)

containing a restriction site for cloning fragments directly downstream of the sequence encoding the site recognized by TEV Protease.

Several other restriction sites are also available for cloning fragments downstream of the primary site, or for directional cloning of a sticky-

ended fragment. A subset of these sites is shared with pTYB21 and pKLAC2. If an insert is subcloned using these sites, it can be subcloned

into any of the vectors either in parallel or as a subsequent experiment. This simplifies an examination of expression in the IMPACT

™

system (NEB #E6901), and in the Kluyveromyces lactis Protein Expression Kit (NEB #E1000), respectively. Inserts cloned into the

primary site produce a protein of interest that, after cleavage, contains a leucine at its N-terminus following the initial methionine.

Subcloning Strategies

The MCS of the pMAL-c6T vector is designed to simplify subcloning the gene of interest. One strategy is to insert a fragment with an

AlwNI site engineered at the beginning of the gene of interest; the 3´ end of the gene can be engineered to contain a restriction site that is

shared with the MCS (e.g., SbfI-HF), to facilitate ligation. This creates a fragment that can be inserted into pMAL-c6T that has been

digested with AlwNI and a matching restriction enzyme (e.g., SbfI-HF). The fusion protein produced by such a construct, when cleaved by

the TEV protease, yields a protein of interest with one extra Leu residue at its N-terminus following the Met start. An alternate strategy can

be used in conjunction with the NEBuilder HiFi DNA Assembly Kit by designing PCR primers for the gene of interest and adding

sequences that overlap with the pMAL-c6T vector. The NEBuilder web app can aid in the design of the necessary primers. Using this

strategy, the fusion protein produced by such a construct, when cleaved by TEV Protease, yields a protein of interest with no additional

residues at its N-terminus if your protein of interest starts with Gly, Ser, Met, Cys, Asn, His, Thr, Lys, Asp, Gln or Phe. None of these

amino acid residues inhibit TEV Protease cleavage when they are in the P1´ position (6).

Preparing a PCR Fragment for Cloning

The procedure below is for cloning a fragment produced by PCR into the pMAL-c6T vector. It is assumed that the PCR fragment is

approximately 1 kb, begins with an AlwNI site, and has a SbfI overhang at the 3´ end.

1. Digest 0.5 µg of the pMAL-c6T vector DNA in 20 µl of 1X CutSmart

Buffer (supplied as a 10X stock) with 10 units of AlwNI (NEB

#R0514) and 10 units of SbfI-HF (NEB #R3642) at 37°C for 1 hour. Heat inactivate the enzymes by incubating at 65°C for 10

minutes.

2. Check for complete digestion of the pMAL-c6T vector by running 4 µl on an agarose gel. At the same time, run a sample of the PCR

fragment to estimate its concentration.

3. Clean up the PCR fragment using the Monarch

PCR & DNA Cleanup Kit (NEB #T1030). Then digest 0.5 µg of the PCR fragment in

20 µl of 1X CutSmart Buffer with 10 units of AlwNI and 10 units of SbfI-HF.

4. Purify the pMAL-c6T vector backbone and the digested PCR fragment by agarose gel using the Monarch DNA Gel Extraction Kit

(NEB #T1020).

5. Run a sample of the PCR insert and the vector backbone on a gel to check the concentration.

6. Mix: 20–40 ng digested vector backbone

20 ng digested insert DNA

Add H

O to bring the volume to 5 µl

Add 5 µl Instant Sticky-end Ligase Master Mix (2X) (NEB #M0370)

Mix thoroughly by pipetting up and down

Place on ice or store at –20°C for subsequent transformation.

7. Transform 2 µl of the assembled product into competent NEB Express cells (NEB #C2523); see transformation protocol on p. 5.

NEBuilder Assembly of a PCR Fragment

The procedure below is for cloning a fragment produced by PCR with overlapping sequences to a pMAL-c6T vector digested with AlwNI

and SbfI-HF using the NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621). It is recommended to read the NEBuilder manual or

use the NEBuilder Assembly Tool to create primers with the correct overlapping sequences for assembly.

1. Digest 0.5 µg of the pMAL-c6T vector DNA in 20 µl of 1X CutSmart Buffer (supplied as a 10X stock) with 10 units of AlwNI (NEB

#R0514) and 10 units of SbfI-HF (NEB #R3642) at 37°C for 1 hour. Heat inactivate the enzymes by incubating at 65°C for 10

minutes.

2. Check for complete digestion of the pMAL-c6T vector by running 4 µl on an agarose gel.

3. Clean up the PCR fragment using the Monarch PCR & DNA Cleanup Kit (NEB #T1030).

4. Purify the pMAL-c6T vector backbone by gel using the Monarch DNA Gel Extraction Kit (NEB #T1020).

5. Run a sample of the PCR insert and the vector backbone on a gel to check the concentration. The recommended DNA molar ratio is

vector : insert = 1 : 2

6. Mix: 0.015–0.1 pmol of digested vector backbone

0.03–0.2 pmol digested insert DNA

Add deionized H

O to bring the volume to 10 µl

Add 10 µl NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621)

Mix thoroughly by pipetting up and down

7. Incubate samples in a thermocycler for 15 minutes at 50°C. Following incubation, store samples on ice or at –20°C for subsequent

transformation.

8. Transform competent NEB Express cells (NEB #C2523) with 2 µl of the assembled product: see transformation protocol below.

Transformation Protocol

1. Thaw chemically competent NEB Express cells (NEB #C2523) on ice.

2. Add 2 µl of the chilled assembled product to the competent cells. Mix gently by pipetting up and down. Do not vortex.

3. Place the mixture on ice for 30 minutes. Do not mix.

4. Heat shock at 42°C for 30 seconds. Do not mix.

5. Transfer tubes to ice for 2 minutes.

6. Add 950 µl of room-temperature SOC media to the tube.

7. Incubate the tube at 37°C for 60 minutes. Shake vigorously (250 rpm) or rotate.

8. Warm LB plates containing 100 µg/ml ampicillin to 37°C.

9. Spread 100 µl of the cells onto the LB ampicillin plates. Do not plate on IPTG.

10. Incubate overnight at 37°C.

11. Screen for the presence of inserts in one or more of the following ways:

A. Perform colony PCR on several transformants using appropriate primers (see Appendix C item 1.2, p. 13).

B. Prepare miniprep DNA (7). Digest with an appropriate restriction endonuclease to determine the presence and orientation

of the insert (8).

C. SDS-PAGE analysis of transformed cells:

1. Inoculate several transformants into 5 ml of LB containing 100 µg/ml ampicillin and grow to 2 x 10

cells/ml

(OD

600

of ~ 0.5).

2. Split each sample into two 2.5 ml cultures.

3. Add IPTG to one of the cultures to a final concentration of 0.3 mM, for example add 7.5 μl of a 0.1 M IPTG stock

solution. Incubate at 37°C with good aeration for 2 hours.

4. Withdraw a 0.5 ml sample from each culture. Microcentrifuge for 1 minute, discard the supernatant and resuspend the

cells in 100 μl SDS-PAGE sample buffer (NEB #B7703).

5. Place samples in a boiling water bath for 5 minutes. Analyze 10 μl of each sample by SDS-PAGE along with a

protein standard (NEB #P7717) and 15 μl of the supplied MBP6 in SDS-PAGE Sample Buffer. Stain the gel with

Coomassie brilliant blue (9).

For pMAL-c6T constructs, an induced band should be visible at a position corresponding to the molecular weight of the fusion protein.

A band at or around the position of MBP6 (MW 45.5 kDa) indicates either an out of frame fusion or a severe protein degradation problem.

These can usually be distinguished by performing a Western blot using the Anti-MBP Monoclonal Antibody (Appendix B); even with severe

protein degradation, a full-length fusion protein can usually be detected on the Western.

Figure 2. Protein expression using the NEBExpress MBP Fusion and Purification System.

SDS-polyacrylamide gel electrophoresis of fractions from the affinity purification of MBP6-TEV-Paramyosin

Sal.

Lane 1: Protein Standard. Lane 2: uninduced cells. Lane 3: induced cells. Lane 4: purified fusion protein eluted from amylose column with

maltose. Lane 5: purified protein after TEV Protease cleavage. Lane 6: target protein isolated from NEBExpress Ni Resin flow through.

Affinity Chromatography

Small Scale

To test multiple different clones to vary induction conditions for expression of a soluble fusion protein it is often easiest to use Amylose

Magnetic Beads (NEB# E8035) to isolate the fusion protein. The binding capacity of these beads is 10 μg of fusion protein per mg of

amylose magnetic beads. The following protocol is for the isolation of MBP-fusion protein from 200-500 µl cell culture supernatant.

MBP Column Binding Buffer

20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA, 1 mM DTT (optional), pH 7.5.

1. Vortex and thoroughly suspend Amylose magnetic beads.

2. Aliquot 100 µl of bead suspension to a sterile microcentrifuge tube.

3. Add 500 µl of MBP column buffer and vortex to suspend. Apply magnet for 30 seconds to pull beads to the side of the tube and

remove supernatant. Repeat wash.

4. Add 200-500 µl of cell culture supernatant to beads.

5. Mix thoroughly and incubate at 4°C with agitation for 1 hour.

6. Apply magnet and remove supernatant.

7. Wash beads three times as in Step 3 above.

8. The purified MBP-fusion protein can now be eluted from the beads or used directly for capture of target proteins.

MBP-Fusion Elution:

1. Add 50 µl of MBP column buffer containing 10 mM maltose (elution buffer) to the bead pellet, vortex and incubate for 10 minutes at

4°C with agitation.

2 Apply magnet and pipet eluted MBP-fusion protein into a clean microcentrifuge tube.

3. Add an additional 50 µl of elution buffer to the beads and repeat elution step. Pool elution supernatants.

Note: Efficiency of elution can be checked by eluting any protein that remains bound to the Amylose Magnetic Beads with 50 µl of

SDS-PAGE gel loading buffer and analyzing 15 µl by SDS-PAGE.

Large Scale

A protocol for purification of a fusion protein from a 1-liter culture is detailed below.

1. Inoculate 1-liter rich broth supplemented with 0.2% glucose & 100 µg/ml ampicillin (see Media and Solutions, p. 11) with 10 ml of an

overnight culture of cells containing the fusion plasmid.

Glucose is necessary in the growth medium to repress the maltose genes on the chromosome of the E. coli host, one of which is an

amylase which can degrade the amylose on the affinity resin.

2. Grow to 2 x 10

cells/ml (OD

600

~0.5). Add IPTG to a final concentration of 0.3 mM, e.g., 72 mg or 3 ml of a 0.1 M stock in H

(see Media and Solutions). Incubate the cells at 37°C for 2 hours.

The length of time and the temperature to use during expression depends on several factors (stability of the protein, host strain, etc.)

and variations can be tested to find optimum conditions.

3. Harvest the cells by centrifugation at 4000 x g for 20 minutes and discard the supernatant. Resuspend the cells in 25 ml Column

Buffer (see Media and Solutions).

For many unstable proteins, most of the degradation happens during harvesting and cell breakage. Therefore, it is best to harvest the

cells quickly and keep them chilled. 25 ml of Column Buffer is based on the expectation of about 4-5 grams cells/liter, i.e., 5 ml for

every gram of cells (wet weight).

The EDTA in the lysis buffer is to help inhibit proteases that have a Ca

cofactor. Addition of PMSF (phenyl methylsulfonyl fluoride)

and/or other protease inhibitors may help in some cases.

DTT or

–mercaptoethanol can be included to prevent oxidative damage to the fusion protein and interchain disulfide bond formation

upon lysis (disulfide bonds usually do not form intracellularly in E. coli). For more about variations and additions to the Column

Buffer, see Media & Solutions, p. 11.

4. Freeze resuspended cells overnight at –20°C.

This is a good place to stop in this protocol. The frozen cells can be stored for a week or more at –20°C, depending on the particular

fusion.

5. Thaw the resuspended cells. Do not use lysozyme during lysis, as it can break down the amylose resin. Place metal cup containing the

resuspended cells and stir bar in an ice-water bath. Stir cells slowly and sonicate in short pulses of 15 seconds or less. Monitor the

release of protein using the Bradford assay (10), adding 5 μl of the sonicate to 1 ml Bradford reagent and mixing. Continue sonication

until the released protein reaches a maximum (usually about 2 minutes sonication time).

6. Centrifuge the lysate at 20,000 x g for 20 minutes. Save the supernatant (crude extract). Dilute the crude extract 1:5 with Column

Buffer.

This is another good place to stop the protocol. The crude extract can be stored for a week or more at –20°C, depending on the

particular fusion. It is usually more convenient to store the crude extract before diluting with column buffer; dilute it after thawing.

7. Pour the amylose resin in a 2.5 x 10 cm column. Wash the column with 5 column volumes of Column Buffer.

The amount of resin required depends on the amount of fusion protein produced. The resin binds 4 mg/ml bed volume, so a column of

about 25 ml should be sufficient for a yield of up to 100 mg fusion protein/liter culture.

8. Load the diluted crude extract at a flow rate of no more than [50 x (diameter of column in cm)

] ml/hour. This is a maximum of 5

ml/minute for a 2.5 cm column. Slower flow rates may increase MBP-fusion binding to the amylose resin; however, the crude extract

should not be incubated with the amylose resin overnight, because native E. coli amylases can break down the resin and decrease its

binding capacity.

9. Wash with 12 column volumes of Column Buffer at a rate of no more than [100 x (diameter of column in cm)

] ml/hour. This is a

maximum of 10 ml/minute for a 2.5 cm column.

The column can be washed overnight if it has a safety loop to prevent it from running dry. In this case, it is better to restart the column

with elution buffer (Step 10), rather than continuing the wash. Avoid loading the column overnight.

10. Elute the fusion protein with Column Buffer + 10 mM maltose. Collect 10 to 20 3 ml fractions (fraction size = 1/5

column volume).

The fusion protein usually starts to elute within the first 5 fractions and should be easily detected by UV absorbance at 280 nm or the

Bradford protein assay (10).

11. Pool the protein-containing fractions. If necessary, concentrate to ~1 mg/ml in a Vivaspin Centrifugal Concentrator (Sartorius), or the

equivalent.

Regenerating the Amylose Resin Column

The resin may be re-used three to five times when regenerated with the following sequence of washes:

Water: 3 column volumes

0.1% SDS: 3 column volumes

Water: 1 column volumes

Column Buffer: 3 column volumes

20% Ethanol: 3 column volumes (long term storage)

Please note that, although the column can be washed at 4°C, 0.1% SDS will eventually precipitate at that temperature. It is therefore

recommended that the SDS solution be stored at room temperature until needed and rinsed out of the column promptly.

Upon repeated use, trace amounts of amylase in the E. coli extract decrease the binding capacity of the column. It is recommended that the

column be washed promptly after each use. The resin should be stored in 20% ethanol for long term storage.

Cleavage of the Fusion Protein

MBP and the target protein are fused by a polylinker containing a TEV protease recognition site for easy removal of the MBP-tag. One unit

of TEV Protease will cleave approximately 2 µg of fusion protein. Cleavage should be carried out in 1X TEV Protease Reaction Buffer or

in Amylose column elution buffer supplemented with DTT to a final concentration of 1 mM. Incubate the reaction mixture for 1 hour at

30°C or overnight at 4°C. Depending on the particular fusion protein, the amount of TEV Protease can be adjusted to get an acceptable rate

of cleavage. TEV Protease is highly specific and will not cleave at non-canonical sites. The optimum sequence for the TEV protease

cleavage site is Glu-Asn-Leu-Tyr-Phe-Gln-(Gly/Ser). However, it has been reported that other amino acid residues can be used in the P1´

position instead of Ser or Gly. These alternative P1´ amino acids include Ala, Met, and Cys (6). If the fusion protein sample contains > 2 M

urea, > 0.5 M guanidine hydrochloride, > 50 mM imidazole, pH values below 6 or above 9, or cysteine protease inhibitors, then it will be

necessary to dialyze the fusion protein before TEV Protease cleavage.

1. If necessary, concentrate the fusion protein to at least 0.5 mg/ml.

2. Perform a pilot experiment with a small portion of your protein. For example:

a. Combine 15 μg fusion protein and H

O to a volume of 45 μl.

b. Add 5 μl of TEV Protease Reaction Buffer (10X) to make a 50 μl total reaction volume.

c. Add 1 μl of TEV Protease.

d. In a separate tube, combine 5 μg fusion protein, 5 μl TEV Protease Reaction Buffer (10X) and H

O to a volume of 50 μl.

Do not add TEV Protease (control sample).

e. Incubate reaction and control sample for 1, 3, and 8 hours at 30°C (an additional reaction can be made and incubated for 24

hours at 4°C).

f. Take 10 μl of the reaction(s) at the indicated times above and add 5 μl SDS-PAGE Sample Buffer (3X). Take 10 µl of the

control sample and add 5 μl SDS-PAGE Sample Buffer (3X) after 8 hours (or longest incubation time).

g. Incubate the SDS-PAGE samples for 3-5 minutes at 70-100°C and analyze them by SDS-PAGE (9).

3. Scale up the pilot experiment linearly for the amount of the fusion protein to be cleaved. Save at least a small sample of the uncut

fusion as a negative control.

4. Check for complete cleavage by SDS-PAGE.

5. TEV Protease and the cleaved MBP contain polyhistidine tags at their N-termini. They can be removed from the cleavage reaction by

immobilized metal affinity chromatography, such as Nickel or Cobalt resin, thereby isolating the target protein in the flow through.

Denaturing the Fusion Protein for Improved TEV Protease Cleavage

If the fusion protein is resistant to TEV Protease cleavage, denaturation and refolding may expose the TEV protease recognition site for

improved cleavage.

1. Either dialyze the fusion against 10 volumes 20 mM Tris-HCl, 6 M guanidine hydrochloride, pH 7.4 for 4 hours, or add guanidine

hydrochloride directly to the sample to give a final concentration of 6 M.

2. Dialyze against 100 volumes Column Buffer for 4 hours, repeat once.

During refolding, one must balance between two objectives. For the protease to cleave it must be present before the protein has

completely refolded, so removing the denaturant quickly is desirable. However, when the denaturant is removed quickly some

proteins will fail to refold properly and precipitate. Stepwise dialysis against buffer containing decreasing amounts of guanidine

hydrochloride can prevent precipitation of the fusion protein; halving the guanidine concentration at each step is convenient, but

cases where 0.1 M steps are necessary have been reported. However, if the fusion protein is able to refold into a protease-resistant

conformation, it may be better to dialyze away the denaturant in one step and take the loss from precipitation in order to maximize

the amount of cleavable fusion protein recovered.

3. Go to Step 2 or 4 above (pilot experiment), as appropriate.

Separating the Protein of Interest from MBP after TEV Protease Cleavage

Both the MBP-tag and TEV Protease are polyhistidine-tagged for easy removal from the TEV Protease reaction. Loading the digest onto

NEBExpress Ni Resin (NEB #S1428) sequesters both the MBP-tag and TEV Protease, thereby isolating the protein of interest in the

column flow through.

The binding capacity of NEBExpress Ni Resin is ≥ 10 mg/ml. The binding capacity will vary depending on the target protein, binding

conditions and the accessibility of the His-tag.

It is recommended to estimate the amount of the His-tagged MBP released by TEV Protease cleavage by first analyzing a sample by SDS-

PAGE and comparing its band size and intensity to that of the provided MBP6 protein control.

Please note that NEBExpress Ni Resin is chemically resistant to DTT. If you are using a resin that is incompatible with DTT, you will need

to buffer exchange or modify the TEV Protease reaction conditions accordingly.

Binding Buffer (for use with NEBExpress Ni Resin): 1X TEV Protease Reaction Buffer (or similar): 50 mM Tris-HCl, 0.5 mM EDTA,

1 mM DTT, pH 7.5

Resin Preparation

1. Gently shake the Ni Resin bottle to completely resuspend the slurry and transfer desired amount to a closed column; allow resin to

settle.

2. Open column and allow storage buffer to flow through.

3. Equilibrate the resin by adding 5 column volumes (CV) of Binding buffer.

Binding

1. Load the TEV Protease digestion directly onto the equilibrated column and allow it to flow through the resin slowly (flow rate < 1

ml/minute). This provides sufficient time for the MBP-tag, TEV Protease, and any remaining MBP-fusion protein to effectively bind

to the Ni resin.

2. Collect the flow through containing the protein of interest in a sterile tube.

3. Wash the column with 1 CV of Binding Buffer to maximize the yield of the target protein; collect the flow through.

4. Dialyze or buffer exchange target protein into desired storage buffer.

Resin Cleaning

1. Add 1 M NaOH to the column and allow a contact time of 1 to 2 hours

2. Add 1.5 M NaCl to the column and allow a contact time of 10 – 15 minutes followed by 10 CV of water.

Resin Storage

1. For long-term storage, NEBExpress Ni Resin should be stored in 20% ethanol at 2 – 8°C.

Pilot Experiment

A small-scale experiment is described to determine the behavior of a particular MBP fusion protein. This protocol results in five samples:

uninduced and induced cells, a total cell crude extract, a suspension of the insoluble material from the crude extract, and a fraction

containing protein that binds to the amylose resin.

1. Inoculate 80 ml rich broth containing 0.2% glucose & ampicillin (see Media and Solutions, p. 11) with 0.8 ml of an overnight culture

of cells containing the fusion plasmid.

2. Grow at 37°C with good aeration to 2 x 10

cells/ml (OD

600

of ~0.5).

3. Take 1 ml sample and microcentrifuge for 2 minutes (sample 1: uninduced cells). Discard supernatant and resuspend the cells in

50 μl SDS-PAGE Sample Buffer. Vortex and freeze at –20°C.

4. Add IPTG (isopropylthiogalactoside) to the remaining culture to a final concentration of 0.3 mM, e.g., 0.24 ml of a 0.1 M stock in

O (see Media and Solutions). Continue incubation at 37°C for 2 hours. Withdraw a 0.5 ml sample and spin down for two minutes

(sample 2: induced cells). Discard supernatant and resuspend the cells in 100 μl SDS-PAGE Sample Buffer. Vortex to resuspend

cells and freeze at –20°C.

Additional time points at 1 and 3 hours can be helpful in trying to decide when to harvest the cells for a large-scale prep.

5. Divide the remaining culture into two aliquots. Harvest the cells by centrifugation at 4000 x g for 10 minutes. Discard the

supernatants and resuspend one pellet in 5 ml of Column Buffer (see Media and Solutions).

6. Freeze the cells in Column Buffer overnight at –20°C. Thaw in cold water.

7. Place the cells in an ice-water bath and sonicate in short pulses of 15 seconds or less. Monitor the release of protein using the

Bradford assay (10), adding 10 μl of the sonicate to 1.0 ml Bradford reagent and mixing. Continue sonication until the released

protein reaches a maximum (usually about 2 minutes).

8. Centrifuge at 20,000 x g at 4°C for 20 minutes. Decant the supernatant (crude extract) and save on ice. Resuspend the pellet in 5 ml

Column Buffer. This is a suspension of the insoluble matter. Add 5 μl 3X SDS-PAGE Sample Buffer to 5 μl of the crude extract and

insoluble matter fractions (samples 3 and 4, respectively).

9. Place ~200 μl of the amylose resin in a microfuge tube and spin briefly in a microcentrifuge or follow the small-scale Amylose

Magnetic Beads (NEB #E8035) protocol on p. 6. Remove the supernatant by aspiration and discard. Resuspend the resin in 1.5 ml

Column Buffer, then microcentrifuge briefly and discard the supernatant; repeat. Resuspend the resin in 200 μl of Column Buffer.

Mix 50 μl of crude extract with 50 μl of the amylose resin slurry. Incubate for 15 minutes on ice. Microcentrifuge 1 minute, then

remove the supernatant and discard. Wash the resin with 1 ml Column Buffer, microcentrifuge 1 minute, discard the supernatant, and

resuspend the resin in 50 μl 3X SDS-PAGE Sample Buffer (sample 5: protein bound to amylose).

SDS-PAGE

10. Incubate the samples for 3-5 minutes at 100°C. Microcentrifuge for 1 minute. Load 20 μl of the of uninduced cells, induced cells and

amylose resin samples (avoid disturbing the pellets), and the entire volume of the remaining samples onto a gel and analyze by SDS-

PAGE (9).

Grow Cells

Add IPTG

Harvest Cells

Sample 1: Uninduced Cells

Sample 2: Induced Cells

Resuspend in Column Buffer

Prepare Total Cell Extracts

Sample 3: Crude Extract

Sample 4: Insoluble Matter

Sample 5: Protein Bound to Amylose

Test Amylose Resin Binding

SDS-PAGE

11. (Optional) Run an identical SDS-PAGE gel(s) after diluting the samples 1:10 in SDS-sample buffer. Prepare a Western blot(s) and

develop with Anti-MBP Monoclonal Antibody (NEB #E8032) and, if available, serum directed against the protein of interest

(Appendix B).

Note: If the protein is insoluble, modify the conditions of cell growth to attempt to produce soluble fusion. Two changes that have

helped in previous cases are i) changing to a different strain background, and ii) growing the cells at a lower temperature (11).

Appendix A: Media and Solutions

Rich Medium + Glucose & Ampicillin:

Per 1 liter: Combine 10 g tryptone, 5 g yeast extract, 5 g NaCl and 2 g glucose.

Autoclave; add sterile ampicillin to 100 μg/ml

0.1 M IPTG Stock

1.19 g IPTG; add H

O to 50 ml; filter sterilize, store at 4°C. Protect from light.

Column Buffer

PER LITER

FINAL CONCENTRATION

20 ml 1.0 M Tris-HCl, pH 7.5

20 mM Tris-HCl

11.7 g NaCl

200 mM NaCl

2.0 ml 0.5 M EDTA

1 mM EDTA

OPTIONAL

1.0 ml 1M sodium azide

1 mM sodium azide

0.7 ml β-mercaptoethanol

154 mg DTT

10 mM β-ME

1 mM DTT

Notes on Additions or Changes to the Column Buffer

The conditions under which MBP-fusions will bind to the column are flexible, and the Column Buffer can be modified without adversely

affecting the affinity purification. Other buffers that are compatible include MOPS, HEPES and phosphate, at pH values from 6.5 to 8.5.

MBP binds to amylose primarily by hydrogen bonding, so higher ionic strength does not decrease its affinity. Nonionic detergents can be

used at concentrations of 0.05% or lower, as higher concentrations interfere with the affinity of some fusions.

Appendix B: Western Protocol

Materials

Transfer apparatus and associated buffers

Nitrocellulose or PVDF membrane

TBST (20 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20)

Blocking Buffer (TBST + 5% Nonfat Dry Milk)

Anti-MBP Monoclonal Antibody (NEB #E8032)

Secondary Antibody: Anti-Mouse IgG (H+L) Dylight

800 4X PEG conjugate (Cell Signaling Technologies, #5257P)

For a 10 cm x 10 cm gel

1. Run the samples on SDS-PAGE - load about 1/5

to 1/10

the amount that would normally be run for a Coomassie stained gel.

2. Transfer protein from the gel to a nitrocellulose or PVDF membrane following the directions of the transfer apparatus manufacturer.

Mark the wells of the gel on the filter with a blunt pencil before removing and discarding the gel.

3. Rinse the membrane with TBST.

4. Incubate the membrane with 25 ml blocking buffer for 1 hour at room temperature (or overnight at 4°C) with gentle shaking.

5. Wash the membrane in 25 ml TBST at room temperature with gentle shaking, 3 times for 5 minutes each.

6. Add 1 μl of the Anti-MBP Monoclonal Antibody to 10 ml blocking buffer (a 1/10,000 dilution). Cover the membrane with the

antibody dilution and incubate for 1 hour at room temperature with gentle shaking.

7. Wash the membrane in 25 ml TBST at room temperature with gentle shaking, 3 times for 5 minutes each.

8. Make a dilution of an Anti-Mouse IgG Secondary Antibody in 10 ml blocking buffer according to the manufacturer’s

recommendation and incubate the membrane in the solution for 1 hour in a container that blocks light.

9. Wash the membrane in 25 ml TBST at room temperature with gentle shaking, 3 times for 5 minutes each.

10. Follow the manufacturer’s directions for detection.

Appendix C: Troubleshooting and Tips

1. Cloning and Transformation

1.1 Strain recommendations

1.2 Sequencing primers

1.3 Inability to clone

1.4 Low yield of DNA in plasmid preps

1.5 Obtaining pMAL sequences

2. Expression

2.1 Fusion protein is degraded

2.2 Fusion protein is insoluble

2.3 Fusion protein not expressed

2.4 Only MBP-sized protein expressed

2.5 Expressing small peptides

3. Affinity Purification

3.1 Fusion protein does not bind to amylose column

3.2 Amylose resin regeneration

3.3 Nonionic detergents and binding

3.4 Different buffers and salt concentrations

3.5 Degradation of the fusion upon cell lysis

3.6 Extra (unexpected) bands upon SDS-PAGE

3.7 Batch purification

3.8 Purification in the presence of denaturants

3.9 Storage of resin at –20°C

4. TEV Protease Cleavage

4.1 Control substrates

4.2 Removal of TEV Protease

4.3 Fusion will not cleave

4.4 Molecular weight and calculated pI

4.5 Cleavage in glycerol

4.6 Cleavage in urea, guanidine hydrochloride and SDS

5. Separation of Fusion Protein Domains and Storage

5.1 Separation of MBP and TEV Protease from the protein of interest

5.2 Difficulties with removal of maltose by dialysis

5.3 How to store proteins

6. MBP6

6.1 What is MBP6?

6.2 Crystal structure of MBP

6.3 How much of MBP is dispensable for binding?

6.4 Kd, pI and extinction coefficient for MBP

6.5 Origin of the MBP region

6.6 Is MBP a monomer?

1. Cloning and Transformation

1.1 What strain(s) do you recommend as hosts for the pMAL vectors?

The strain we recommend is NEB Express (NEB #C2523). This is an E. coli B strain similar to T7 Express and BL21 (DE3),

except that it lacks the T7 RNA Polymerase (the pMAL vectors use the E. coli RNA Polymerase). NEB Express, T7 Express

(NEB #C2566), BL21 (NEB #C2530) and BL21(DE3) (NEB #C2527) all give similar results – the presence of the T7 RNA

Polymerase doesn't seem to have any effect. Other successful strains include NEB 10-beta (NEB #C3019), NEB 5-alpha (NEB

#C2991) and NEB Turbo (NEB #C2984). We also use other strains in response to a particular problem (for example, see 2.1).

One can start with NEB Express, or with whatever competent cells are readily available, and then try another strain if a problem

with expression or purification develops.

1.2 What primers should I use to sequence the ends of my insert after I clone it into a pMAL vector?

The following sequencing primers can be used (not available from New England Biolabs): malE primer on the 5´ side of the

insert and the pMAL reverse primer for sequencing from the 3´ side.

Forward Primer (24-mer, upstream of MCS)

5´d(GGTCGTCAGACTGTCGATGAAGCC)3´

Reverse Primer (24-mer, downstream of MCS)

5´d(TGTCCTACTCAGGAGAGCGTTCAC)3´

The sequences of the pMAL vectors are also available at www.neb.com. PCR of inserts cloned into the MCS can be performed

using the same primer pair.

1.3 What are some of the possible explanations for an inability to clone an insert into a pMAL vector?

The most common explanation for this is technical difficulties with the subcloning. Another explanation is that expression of the

fusion is toxic to E. coli. The tac promoter induction ratio on the pMAL plasmids is about 1:30, so if the induced level of the

fusion is 40% of the total cellular protein, the uninduced level works out to over 1%. This amount of a protein can be toxic,

either because of its function (e.g., a protease) or because of its general properties (e.g., very hydrophobic).

1.4 Why is the yield of pMAL DNA from plasmid preps so low?

The pMAL plasmids are pBR322-low copy number, but for unknown reasons the yield from plasmid preps is often lower than

what can be obtained from pBR322. However, modification of the standard alkaline lysis protocol can increase the yield:

increasing the volume of the buffers by 1.5-fold doubles the yield of plasmid (i.e., for a 500 ml culture, resuspend the cell pellet

in 15 ml instead of the standard 10 ml, and increase the denaturing and neutralizing buffer amounts proportionately).

1.5 How can I obtain the sequence of the pMAL-c6T vector?

The pMAL sequence is available in the Tools and Resources > Interactive Tools section of the New England Biolabs web site at

https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool

2. Expression

2.1 When I analyze my fusion protein expression by Western blot using the Anti-MBP Monoclonal Antibody, only a small fraction

of the protein is full-length, while most of it migrates close to the MBP6* marker.

It is likely that the fusion protein is degraded, leaving a stable MBP-sized breakdown product. In this case, try using a protease

deficient host such as NEB Express, which is Lon- and OmpT-. Additionally, try adding a protease inhibitor cocktail to the lysis

buffer.

2.2 My fusion protein is insoluble; is there anything I can do to express it as soluble protein?

Expressing at a lower temperature is the first thing to try. One can go as low as 15°C by moving an incubator into the cold

room. Of course, the cells grow very slowly at these temperatures, so grow the culture at 37°C and shift to the low temperature

when adding IPTG. One must also increase the time of induction to compensate for the slower growth–a rule of thumb is 2X for

every 7°C. Other references for solubility problems include:

Reviews on methods to make correctly folded protein in E. coli:

Georgiou, G. et al. (1996) Current Opinion in Biotechnology 7:190–197.

Sahdev S. et al. (2008) Mol. Cell Biochem 307:249–264

Reviews on refolding:

Qoronfleh, M.W. et al. (2007) Protein Expr. Purif. 55, 209–224.

Jungbauer, A. and Kaar, W. (2007) J. Biotechnol. 128, 587–596.

Jungbauer, A. et al. (2004) Curr. Opin. Biotechnol. 15, 487–494.

Vallejo, L.F. and Rinas, U. (2004) Microb. Cell Fact 3, 11–22.

2.3 When I run my uninduced and induced crude extracts on SDS-PAGE side by side, I don’t see an induced band.

There are a couple of possible explanations. Some foreign genes are poorly expressed in E. coli, even when fused to a highly

expressed carrier gene. Possible explanations are message instability or problems with translation–sometimes it is due to the

presence of multiple rare codons in the gene of interest, and in these cases overexpression of the corresponding tRNA can help

(12). Even in cases where a band is not visible, one can get yields up to 5 or 6 mg/liter of culture.

2.4 I’ve cloned my insert, but after SDS-PAGE the only induced band present is the size of MBP6*.

There are two likely explanations for this result. If the protein of interest is in the wrong translational reading frame, an MBP6-

sized band will be produced by translational termination at the first in-frame stop codon. If the protein of interest is very

unstable, an MBP6-sized breakdown product is usually produced (MBP is a very stable protein). The best way to distinguish

between these possibilities is to run a Western blot using Anti-MBP Monoclonal Antibody (NEB #E8032). If proteolysis is

occurring, at least a small amount of full-length fusion can almost always be detected. DNA sequencing of the fusion junction

will confirm a reading frame problem. If the problem is proteolysis, you might want to try NEB Express (NEB #C2523) which

is a protease deficient strain lacking the Lon and OmpT proteases.

2.5 What is the minimum size of a fragment that can be cloned into pMAL and expressed fused to MBP?

Can short peptide sequences (about 10 amino acids) be added onto MBP?

The MBP system can be used to express short peptides. However, 40 mg of MBP yields ~1 mg of a 10 amino acid peptide

(1.1 kDa).

3. Affinity Purification

3.1 Much of my fusion protein flows through the amylose column. Is there anything I can do to improve my fusion’s affinity for the

amylose column?

An MBP fusion protein might not stick to the amylose column because of the presence of some factor in the extract that

interferes with binding, or because of a low intrinsic affinity. Factors in the crude extract that can interfere with binding include

nonionic detergents (see 3.3) and cellular components that are released during alternative methods of lysis (prolonged treatment

with lysozyme or multiple passes through a French press). In addition, cells grown in LB and similar media have substantial

amounts of an amylase that interferes with binding, presumably by either cutting the fusion off the column or by releasing

maltose that elutes the fusion from the column. By including glucose in the media, expression of this amylase is repressed, and

the problem is alleviated. A low intrinsic affinity could be caused by an interaction between the protein of interest and MBP that

either blocks or distorts the maltose-binding site. Although this may be inherent in the protein of interest, sometimes the

problem can be alleviated by shortening or lengthening the polypeptide that is fused to MBP. Alternatively, because the MBP

possesses an N-terminal hexahistidine tag, it is possible to purify the MBP-fusion via Immobilized Metal Affinity

Chromatography.

3.2 How many times can I use the amylose column?

The most important variable in determining the useful life of the amylose resin is the amount of time it is in contact with trace

amounts of amylase present in the crude extract (see 3.1). Under normal conditions (crude extract from 1 liter of cells grown in

LB + 0.2% glucose, 15 ml column), the column loses 1–3% of its initial binding capacity each time it is used. If the yield of

fusion protein under these conditions is 40 mg, this means that after 3 to 5 runs there would be a decrease in the yield. In

practice, we often use a column 8 or 10 times before we notice a significant drop in the yield.

3.3 What is known about binding in the presence of nonionic detergents?

Some fusion proteins do not bind efficiently (< 5% binding) in the presence of 0.2% Triton X–100 or 0.25% Tween-20, while

other fusions are unaffected. For one fusion that does not bind in 0.25% Tween- 20, diluting the Tween-20 to 0.05% typically

restores about 80% of the binding.

3.4 Can I substitute a different buffer and/or salt concentration in the Column Buffer?

Yes, HEPES, MOPS, and phosphate buffers (at pH values ranging from 6.5 to 8.5) can be used instead of Tris-HCl in the

Column Buffer with similar results. NaCl or KCl concentrations of 25 mM to 1 M are also compatible with the affinity

purification.

3.5 I see my intact fusion protein by SDS-PAGE when I run cells boiled in Sample Buffer, but when I check the crude extract the

fusion is degraded.

For fusions expressed in the cytoplasm, in many cases most of the degradation happens during harvest and lysis. Harvesting

promptly and lysing the cells quickly may help. In other cases, degradation occurs when the fusion protein is exposed to

periplasmic or outer membrane proteases (13-15). The best strategy in either case is to use a host which is deficient in the

offending protease(s) and a protease inhibitor cocktail during lysis (see 2.1).

3.6 When I run my purified fusion protein on SDS-PAGE, why do I see multiple bands instead of a single band of the expected MW?

There are two likely explanations for this result. The first is that the fusion protein is unstable, which most often leads to

degradation in vivo (see 3.5). In this case, one would expect to see bands between the size of MBP (45.5 kDa) and the size

expected for the full-length fusion, since fragments smaller than MBP would not bind to the affinity column. An exception

would be if the fusion protein breaks down at the junction between MBP and the protein of interest, and the protein of interest

oligomerizes. In this situation, the protein of interest may bind to the fusion protein, and therefore a band the size of the protein

of interest can appear even if it is smaller than MBP. The second explanation is that the protein of interest is binding non-

specifically to other E. coli proteins, e.g., it has a surface that binds other proteins by electrostatic or hydrophobic interactions.

In this case, modifications to the column buffer can sometimes be used to help wash the interacting proteins away. Electrostatic

interactions can be weakened by including up to 1 M NaCl in the column buffer, and hydrophobic interactions can be weakened

by lowering the salt to 25–50 mM NaCl and including 5% ethanol or acetonitrile in the column buffer. Non-ionic detergents can

also be used to weaken hydrophobic interactions, but they can interfere with the affinity of certain fusion proteins.

3.7 Can I perform a batch purification using the amylose resin?

Yes, batch purification works well, although it is difficult to wash all the nonspecific proteins away as effectively as in a column

due to the included volume in the resin. The resin can withstand centrifugation at up to 6000 x g. A good compromise is to load

the resin in a batch mode, by incubating with shaking for 2 hours to overnight, then pour it in a column to wash and elute.

Dilution of the crude extract may not be critical for loading the column by the batch method.

3.8 Can MBP fusions be purified in the presence of denaturants like urea or guanidine-HCl?

No, MBP’s affinity to amylose and maltose depends on hydrogen bonds that in turn are positioned by the three-dimensional

structure of the protein. Agents that interfere with hydrogen bonds or the structure of the protein interfere with binding as well.

3.9 Is the amylose resin damaged by storage at –20°C? When our kit arrived, it was placed at –20°C, but I see that the

recommended storage temperature for the amylose resin is 4°C.

The resin will freeze at –20°C but the performance of the resin is not degraded by one freeze/thaw cycle. After the ethanol is

removed, the resin should be stored at 4°C to prevent damage from freezing.

4. TEV Protease Cleavage

4.1 Are there any control substrates for TEV Protease?

The NEBExpress MBP Fusion and Purification System comes with an MBP6-TEV-Paramyosin-ΔSal fusion as a positive

control for TEV Protease cleavage.

4.2 How can TEV Protease be removed from the reaction after cleavage?

TEV Protease contains a polyhistidine tag at its N-terminus and can be removed from the reaction by immobilized metal affinity

chromatography, such as NEBExpress Ni-NTA Magnetic Beads (NEB #S1423), NEBExpress Ni Spin Columns (NEB #S1427),

or NEBExpress Ni Resin (NEB #S1428). The Ni-NTA Magnetic Beads will require dialysis to remove the DTT present in the

TEV Protease reaction buffer; whereas, TEV Protease digests can be directly loaded onto NEBExpress Ni Spin Columns or

NEBExpress Ni Resin since these two resin formats are chemically resistant to DTT.

4.3 My protein cleaves very poorly with TEV Protease. Is there anything I can do to improve cleavage?

In these cases, the fusion protein may be folded in a way that the TEV site is inaccessible. In theory, anything that perturbs the

structure might uncover the site, such as denaturing and refolding (see “Denaturing the Fusion Protein”, p. 8) or addition of a

chaotropic reagent (up to 2 M urea, up to 3 M guanidine HCl, or up to 0.5% SDS). One approach that often helps is to add

amino acid residues to the N-terminus of the protein; either by cloning into one of the downstream sites in the polylinker, or by

adding codons to the insert (e.g., adding four alanine codons before the start of the gene). Be aware that with this strategy, the

extra residues remain at the N-terminus after TEV Protease cleavage.

4.4 What is the molecular weight and pI of the TEV Protease?

The molecular weight of TEV Protease is 27,900 daltons. The pI of TEV Protease is ~8.5.

4.5 What is maximum concentration of glycerol that TEV Protease can tolerate during cleavage?

TEV Protease retains ~50% activity in solutions containing 50% glycerol.

4.6 Is the rate of TEV Protease cleavage affected by urea, guanidine hydrochloride and/or SDS?

The activity of TEV Protease on an MBP-fusion protein in the presence of these denaturants has been reported by C. Sun et al.

(16) as follows:

Urea: In up to 2 M urea near complete cleavage is detected. There is some inhibition of TEV Protease cleavage in urea

concentrations of 4 M.

Guanidine HCl: 1 M guanidine HCl yields slight inhibition of TEV Protease cleavage; however, some TEV Protease activity is

still observed in the presence of 3 M guanidine HCL.

SDS: TEV Protease is unaffected by concentrations of SDS below 0.5%. In the presence of 1% SDS, TEV Protease retains

most, but not all, of its activity.

5. Separation of Fusion Protein Domains and Storage

5.1 How do I separate MBP and TEV Protease from the protein of interest?

Both MBP and TEV Protease contain polyhistidine tags that can be used to remove them from the protein of interest. The TEV

Protease digestion can be directly loaded onto NEBExpress Ni Spin Columns (NEB #S1427) or NEBExpress Ni resin (NEB

#S1428), since these resin formats are chemically resistant to the DTT in the TEV Protease reaction buffer. If using

NEBExpress Ni-NTA Magnetic Beads (NEB #S1423) or another immobilized metal affinity chromatography format, we

recommend dialyzing the TEV Protease digestion into a compatible buffer prior to IMAC.

5.2 I want to rebind MBP to the amylose column, but the maltose must be removed. Can this be done by dialysis?

Dialysis does not work very well to remove maltose from maltose-binding protein. This is a general phenomenon of binding

protein/ligand interactions; after the free ligand is gone, ligand that is released from the binding site usually finds another

binding site before it encounters the dialysis membrane (17). We have determined empirically that binding the fusion to a

chromatography resin and then washing away the maltose is much more effective. Standard chromatography (e.g., DEAE) is a

preferred separation step, since it can separate the TEV Protease and MBP from the protein of interest if immobilized metal

affinity chromatography is not an option. In case MBP co-elutes with the protein of interest, we include a large volume washing

step to remove the maltose before starting the salt gradient. This way, the mixture can be run over an amylose column afterward

if necessary. Alternatively, we recommend utilizing the polyhistidine tags present on both MBP and TEV protease with

immobilized metal affinity chromatography to separate them from the protein of interest following digestion with TEV Protease

(see 5.1).

5.3 How should I store my protein after it is purified?

Most proteins can be stored for at least a few days at 4°C without denaturing. For long term storage, one can either freeze

at –70°C or dialyze into 50% glycerol and store at –20°C. When storing at –70°C, aliquot the protein so only the portion to be

used must be thawed. Repeated freeze/thaw cycles will denature many proteins.

6. MBP6

6.1 What is MBP6? Is it different from wild-type MBP produced from E. coli?

MBP6 is the protein produced from pMAL-c6T that utilizes the naturally occurring stop codon following the SbfI recognition

sequence. It differs from wild-type MBP by the addition of a methionine at the N-terminus (as do all fusions made in

pMAL-c vectors), the mutations that increase the affinity of MBP for the amylose resin, the deletion of the last four residues of

wild-type MBP, and the addition of the residues encoded by the spacer and the TEV protease site.

6.2 Has the crystal structure of MBP been determined?

The references for the crystal structure of MBP are:

Spurlino, J. C. et al. (1991) J. Biol. Chem. 266, 5202–5219 (17)

Sharff, A. J. et al. (1992) Biochem. 31, 10657–10663 (18)

6.3 How much of MBP is dispensable for binding?

The exact region of MBP necessary for binding has not been determined, but the structure indicates that most of the protein is

necessary. From the structure, it appears that very few, if any, residues could be deleted at the C-terminus (other than the

polylinker residues, of course). It is possible that some of the N-terminus could be deleted, but so far this has not been tested.

6.4 What is the K

, pI and extinction coefficient for MBP?

The K

of MBP for maltose is 3.5 μM; for maltotriose, 0.16 μM (19). The extinction coefficient of MBP6 is 1.5 (1 mg/ml,

1 cm path length) and its calculated pI is 4.9.

6.5 What is the origin of the MBP region of the pMAL vectors?

The malE gene in the pMAL vectors was derived from the Hinf I fragment of the E. coli malB region. The Hinf I fragment lacks

the last four amino acids of wild-type malE, and, of course, additional amino acids are added as encoded by the polylinker.

6.6 Is MBP6 a monomer or a higher oligomer?

MBP6 is a monomer with a molecular weight of 45.5 kDa.

Molecular Weights of pMAL Proteins:

MBP6: 45,519 daltons

MBP6-TEV-Paramyosin DSal: 70,103 daltons

TEV Protease: 27,900 daltons

References

1. Guan, C. et al. (1987) Gene 67, 21–30.

2. Maina, C.V. et al. (1988) Gene 74, 365–373.

3. Amann, E. et al. (1985) Gene 40, 183–190.

4. Duplay, P. et al. (1984) J. Biol. Chem. 259, 10606–10613.

5. Kellerman, O.K. et al. (1982) Methods in Enzymology 90, 459–463.

6. Kapust, R.B. et al. (2002) Biochem. Biophys. Res. Comm. 294, 949–955.

7. Sambrook, J. et al. (1989). Molecular Cloning: A Laboratory Manual (2nd ed.) (pp.1.25–1.28). Cold Spring Harbor: Cold Spring

Harbor Laboratory Press.

8. Bloch, K.D. (1989). In F.M. Ausebel et al. (Eds), Current Protocols in Molecular Biology, (pp. 3.1.1–3.2.5). New York: Greene

Publishing & Wiley-Interscience.

9. Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed.) (pp.18.47–18.55). Cold Spring Harbor: Cold

Spring Harbor Laboratory Press; Smith,J.A. (1989). In F.M. Ausebel et al. (Eds). Current Protocols in Molecular

Biology(pp.10.2.1–10.2.7). New York: Greene Publishing & Wiley-Interscience; Sasse,J. (1989). In F.M. Ausebel, et al. (Eds)

Current Protocols in Molecular Biology, (pp.10.6.1–10.6.3). New York: Greene Publishing & Wiley-Interscience.

10. Smith, J.A. (1989). In F.M. Ausebel et al. (Eds) Current Protocols in Molecular Biology, (pp. 10.1.1–10.1.3). New York: Greene

Publishing & Wiley-Interscience.

11. Nagai, K. et al. (1987) Methods in Enzymol. 153, 461–481.

12. Schenk, P.M. et al. (1995) BioTechniques 19,196–200.

13. Silber, K.R. et al. (1992) Proc. Natl. Acad. Sci. USA 89, 295–299.

14. Grodberg, J. et al. (1988) J. Bacteriol. 170, 1245–1253.

15. Sugimura, K. et al. (1988) J. Bacteriol. 170, 3650–3654.32

16. Sun, C. et al. (2012) Protein Expression and Purification 82, 226–231.

17. Silhavy, T.J. et al. (1975) Proc. Natl. Acad. Sci. USA 72, 2120–2124.

18. Spurlino, J.C. et al. (1991) J. Biol. Chem. 266, 5202–5219.

19. Miller, D.M. et al. (1983) J. Biol. Chem. 258, 13665–13672.

20. Richarme, G. (1982) Biochem. Biophys. Res. Comm. 105, 476–481.

Kit Components

NEB #E8201S Table of Components

NEB #

PRODUCT

VOLUME

N0378S

pMAL-c6T Vector

10 µg

E8021S

Amylose Resin

15 ml

P8112S

TEV Protease

1,000 units

B8035S

TEV Protease Reaction Buffer (10X)

1 ml

E8032A

Anti-MBP Monoclonal Antibody

25 µl

E1020S

MBP6 Protein

10 µg

E1021S

MBP6-TEV-Paramyosin DSal

100 µg

E4131S

E. coli NEB Express

0.2 ml cells

COMPANION PRODUCTS

NEB #

PRODUCT

VOLUME

R0514S/L

AlwNI

500/2,500 units

R3642S/L

SbfI-HF

500/2,500 units

T1030S/L

Monarch PCR & DNA Cleanup Kit (5 µg)

50/250 preps

T1020S/L

Monarch DNA Gel Extraction Kit

50/250 preps

M0370S/L

Instant Sticky-end Ligase Master Mix

50/250 reactions

E2621S/L/X

NEBuilder HiFi DNA Assembly Master Mix

10/50/250 reactions

B7703S

Blue Loading Buffer Pack

8 ml

P7717S/L

Unstained Protein Standard, Broad Range (10-200 kDa)

150/750 gel lanes

E8022S/L

Amylose Resin High Flow

15/100 ml

E8035S

Amylose Magnetic Beads

25 mg

E8037S

Anti-MBP Magnetic Beads

10 mg

S1423S/L

NEBExpress Ni-NTA Magnetic Beads

1/5 ml

S1427S/L

NEBExpress Ni Spin Columns

10/25 columns

S1428S

NEBExpress Ni Resin

25 ml bed volume

C2523I/H

NEBExpress Competent E. coli (High Efficiency)

6 x 0.2 ml/20 x 0.05 ml

C3019I/H

NEB 10-beta Competent E. coli (High Efficiency)

6 x 0.2 ml/20 x 0.05 ml

Revision History

REVISION #

DESCRIPTION

DATE

1.0

N/A

2.0

Place pMAL-c6T Polylinker on Figure 1.

1/21

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

This product is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc. For more information about commercial

rights, please email us at [email protected] While NEB develops and validates its products for various applications, the use of this product may require the buyer to obtain

additional third party intellectual property rights for certain applications.

Information presented herein is accurate and reliable to the best of our knowledge and belief but is not guaranteed to be so. Nothing herein is to be construed as recommending any

practice or any product in violation of any patent or in violation of any law or regulation. It is the user’s responsibility to determine for himself or herself the suitability of any

material and/or procedure for a specific purpose and to adopt such safety precautions as may be necessary.

B CORPORATION

™

is a trademark of B Lab, Inc.

DYLIGHT

is a registered trademark of Pierce Biotechnology, Inc.

www.neb.com

New England Biolabs, Inc., 240 County Road, Ipswich, MA 01938-2723 Telephone: (978) 927-5054 Toll Free: (USA Orders) 1-800-632-5227 (USA Tech) 1-800-632-7799 Fax: (978) 921-1350 e-mail: [email protected]

be INSPIRED

drive DISCOVERY

stay GENUINE

ISO 13485

Registered

Medical Devices

ISO 14001

Registered

Environmental

Management

ISO 9001

Registered

Quality

Management