PRODUCT INFORMATION
Thermo Scientific
Phire Plant Direct
PCR Kit
#F-130WH 200 rxns
Lot __ Expiry Date __
d
www.thermoscientific.com/onebio
Ordering information
Component
#F
-
130WH
500 rxns × 20 µL
200 rxns × 50 µL
Phire Hot Start II DNA Polymerase 200 µL
2X Phire Plant PCR Buffer
(includes dNTPs and MgCl
2
)
5 × 1.25 mL
Control Primer Mix (25 µM each) 40 µL
Dilution Buffer 2 × 5 mL
Storage
Upon arrival, store the components at -20 °C. The
Dilution Buffer can also be stored at 4 °C once it is
thawed.
CERTIFICATE OF ANALYSIS
Performance in PCR is tested by the amplification
of 7.5 kb fragment from human genomic DNA.
Quality authorized by: Jurgita Zilinskiene
Rev.4
V
1. Introduction
Thermo Scientific™ Phire™ Plant Direct PCR Kit is
designed to perform PCR directly from plant leaves and
seeds without prior DNA purification. Fresh plants, plant
material stored at 4 °C or frozen are all suitable
templates for this kit, as well as plant material stored on
commercially available cards such as Whatman
®
903 and
FTA
®
Cards. A list of plants tested with this kit is available
at www.thermoscientific.com/directpcr. The kit employs
Phire Hot Start II DNA Polymerase, a specially
engineered enzyme with a DNA-binding domain that
enhances the processivity of the polymerase. Phire Hot
Start II DNA Polymerase also exhibits extremely high
resistance to many PCR inhibitors found in plants. The
Phire Plant Direct PCR Kit contains reagents and tools
for two alternative methods: direct and dilution protocols.
Dilution Buffer is included for optional sample treatment
before PCR (see ‘Dilution protocol’ in Section 4). It can
be used to treat larger/more difficult samples (e.g. more
fibrous or latex-containing samples), or when multiple
PCR reactions are performed from a single sample. It is
also a useful choice when longer DNA fragments (> 1 kb)
are amplified. The kit includes control primers for
amplification of a highly conserved region of chloroplast
DNA
1
. The kit is recommended for end-point PCR
protocols.
2. Important Notes
• Clean the sampling tools between each sample.
• Add the sample into a PCR reaction instead of an
empty tube.
• Use the dilution protocol for difficult samples, for long
amplicons or for performing multiple reactions from the
same sample.
• Use 98 °C for denaturation.
• The annealing temperatures for Phire are different from
many common DNA polymerases (such as Taq DNA
polymerases). Read Section 6.2 carefully.
• For extension, use 20 s for amplicons <1 kb or 20 s/kb
for amplicons > 1 kb.
3. Guidelines for PCR
Carefully mix and spin down all tubes before opening to
ensure homogeneity and improve recovery. The PCR
setup can be performed at room temperature. Always
add the sample last to the reaction.
Table 1. Pipetting instructions
Component
20 µL rxn
50 µL rxn
Final conc.
H
2
O
add to 20 µL
add to 50 µL
2X Phire Plant
PCR Buffer
10 µL 25 µL 1X
Primer A
X µL
X µL
0.5 µM
Primer B
X µL
X µL
0.5 µM
Phire Hot
Start II
DNA Polymerase
0.4 µL 1 µL
Plant tissue (see
Section 4)
Direct protocol
Dilution protocol
0.5 mm
diameter leaf
sample/small
sample of
seed
0.5 µL
0.5 mm
diameter leaf
sample /small
sample of seed
1.25 µL
Table 2. Recommended cycling protocol
Cycle step
2-step protocol 3-step protocol
Cycles
Temp. Time Temp. Time
Initial
denaturation
98 °C 5 min 98 °C 5 min 1
Denaturation
Annealing
(see 6.2)
Extension
(see 6.3)
98
°C
-
72 °C
5
s
-
20 s ≤1 kb
20 s/kb >1 kb
98
°C
X °C
72 °C
5
s
5 s
20 s ≤1 kb
20 s/kb >1 kb
40
Final
Extension
72
°C
4 °C
1 min
hold
72
°C
4 °C
1 min
hold
1
4. Guidelines for sample handling
To obtain small and uniform samples, we recommend
using a puncher that is 0.5 mm or 0.35 mm in diameter. If
the puncher is to be reused, it is very important to clean
the cutting edge properly to prevent cross-contamination
between samples. Use 2% NaOCl solution for cleaning
and cross contamination prevention.
Other ways to take a sample is by cutting with scalpel to
obtain 0.35 – 0.50 mm sample. Scalpel must be cleaned
properly to prevent cross-contamination between
samples.
4.1. Plant leaves
Direct protocol: Take a 0.5 mm diameter sample from
the plant leaf and place it directly into the PCR reaction
(20−50 µL in volume). It is recommended to add sample
into a liquid, rather than onto the wall of an empty tube.
Make sure that you see the sample in the solution. We
recommend using young leaves. Fresh plant material is
usually the best choice, even though plant material stored
at 4 °C, frozen or on commercially available cards such
as Whatman 903 and FTA
Cards can also be used (see
section 4.3). For amplifying long fragments or difficult
samples using the direct protocol, a smaller sample (e.g.
a punch of 0.35 mm in diameter) may give more robust
results.
Dilution protocol: As with the direct protocol, young
leaves are recommended. Take one small leaf or a piece
of leaf (e.g. a punch approximately 2 mm in diameter)
and place it in 20 µL of Dilution Buffer. Crush the leaf
sample with a 100 µL pipette tip by pressing it briefly
against the tube wall. If larger amount of leaf tissue is
used (do not exceed 1 mg), increase the volume of the
Dilution Buffer to 50 µL. After crushing the leaf, the
solution should be greenish in colour. Spin the plant
material down, and use 0.5 µL of the supernatant as a
template for a 20 µL PCR reaction. The required volume
of the supernatant may vary depending on the plant
material used and the volume used for the dilution.
4.2. Plant seeds
Direct protocol: Using a clean scalpel, remove the seed
coat and cut a small sample of the seed (approximately
the size of this dot ●). Place the sample directly into the
PCR reaction (20−50 µL in volume). Note that it is
recommended to use dehulled seeds. For very small
seeds (such as Arabidopsis), use 1−2 whole seeds and
place them directly into the PCR reaction.
Dilution protocol: Cut a small sample of the dehulled
seed by using a scalpel (approximately the size of this
dot ●) and place it directly into 20 µL of Dilution Buffer.
Briefly vortex the tube and incubate at room temperature
for 3 min. Make sure that the seed sample is covered
with Dilution Buffer. Spin briefly and use 0.5 µL of the
supernatant as a template for a 20 µL PCR reaction.
4.3. Plant material stored on commercially available
storage cards, e.g. Whatman 903 and FTA Cards
Direct protocol: Use the 0.50 mm diameter sample from
the storage card. Place the sample directly into a
50 µL PCR reaction. For amplifying long fragments or
difficult samples, a smaller sample of 0.35 mm diameter
may give more robust results.
(continued reverse page)
5. Notes about reaction components
5.1. Enzyme
Phire Hot Start II DNA Polymerase possesses the
following activities: 5´→3´ DNA polymerase activity and a
weak 3´→5´ exonuclease activity. Phire Hot Start II DNA
Polymerase produces blunt ends and therefore blunt end
cloning is recommended. If TA cloning is required, it can
be performed by adding A overhangs to the blunt PCR
product with Taq DNA Polymerase, for example (protocol
available at www.thermoscientific.com/pcrcloning).
5.2. Phire Plant PCR Buffer
The 2X Phire Plant PCR Buffer has been optimized for
direct PCR from plant material. It contains the dNTPs and
provides 1.5 mM MgCl
2
concentration in the final
reaction.
5.3. Dilution Buffer
The Dilution Buffer has been optimized to release DNA
from a wide variety of different sample materials such as
plant leaves and seeds. This buffer is also suitable for
storing the DNA sample for 8 weeks at 4 °C. For long
term storage, it is recommended to transfer the
supernatant into a new tube and store at −20 °C. The
Dilution Buffer is sufficient for 500 dilution reactions
20 µL each.
5.4. Primers
The recommendation for final primer concentration is
0.5 µM. The results from primer Tm calculations can vary
significantly depending on the method used. Always use
the Tm calculator and instructions at
www.thermoscientific.com/pcrwebtools to determine the
Tm values of primers and optimal annealing temperature.
6. Notes about cycling conditions
6.1. Initial denaturation
In Direct PCR protocols, the initial denaturation step is
extended to 5 minutes to allow the lysis of cells, making
genomic DNA available for PCR.
6.2. Primer annealing
Note that the optimal annealing temperature for Phire Hot
Start II DNA Polymerase may differ significantly from that of
Taq-based polymerases. Always use the Tm calculator and
instructions at www.thermoscientific.com/pcrwebtools to
determine the Tm values of primers and optimal annealing
temperature. As a basic rule, for primers > 20 nt, anneal for
5 seconds at a Tm +3 °C of the lower Tm primer. For primers
≤ 20 nt, use annealing temperature equal to the Tm of the
lower Tm primer. In some cases, it may be helpful to use a
temperature gradient to find the optimal annealing
temperature for each template-primer pair combination. The
annealing gradient should extend up to the extension
temperature (two-step PCR). Two-step cycling without an
annealing step is recommended for high-Tm primer pairs
(Tm at least 69−72 °C).
6.3 Extension
The extension is performed at 72 °C. The recommended
extension time is 20 seconds for amplicons ≤1 kb, and 20
s/kb for amplicons >1 kb.
7. Control reactions
7.1. Direct PCR control reaction using the control
primer mix
We recommend performing direct PCR control reactions
with both direct and dilution protocols using the control
primers supplied with this kit. As a template, use the
same plant material as in the actual experiment. If the
PCR using control primer mix is not working, the plant
sample may not be suitable for direct PCR. Control
primers are supplied as a mix of primers in H
2
O that
amplify a 297 bp fragment of a highly conserved region of
chloroplast DNA. The control primer mix has been
validated with a large number of species (refer to the list
of tested plants at www.thermoscientific.com/directpcr).
Each primer concentration is 25 µM.
Primer #1 (20-mer)
5’- AGTTCGAGCCTGATTATCCC -3’
Melting point: 62.4 °C
Primer #2 (20-mer)
5’- GCATGCCGCCAGCGTTCATC -3’
Melting point: 75.5 °C
Table 3. Pipetting instructions for control reactions.
Component
20 µL rxn
Final conc.
H
2
O
add to 20
µL
2X Phire Plant PCR
Buffer
10 µL 1X
Control primer mix
0.4 µL
0.5 µM
Phire Hot Start II DNA
Polymerase
0.4 µL
Plant tissue
(see Section 4)
Direct protocol:
Dilution protocol
0.
3
5 mm
diameter leaf
sample/small
sample of seed
0.5 µL
Table 4. Cycling instructions for control reactions.
Cycle step Temp. Time Cycles
Initial
denaturation
98 °C 5 min 1
Denaturation
Annealing
Extension
98
°C
62 °C
72 °C
5 s
5 s
20 s
40
Final Extension
72
°C
4 °C
1 min
hold
1
Figure 1. Amplification of the 297 bp control DNA
fragment directly from Capsicum, maize, Arabidopsis and
tomato leaves. A 0.50 mm puncher was used to cut a
sample disc from the plant leaves. The samples were
placed directly into 20 µL PCR reactions. After PCR,
5 µL of loading buffer was added to the reaction and
15 µL was used for gel electrophoresis. + denotes the
control reaction with purified plant DNA and – is the
no-template control.
7.2. Positive control reaction with purified DNA
When optimizing the reactions, it is recommended to
perform a positive control with purified DNA to ensure
that the PCR conditions are optimal. If the positive control
with purified DNA fails, the PCR conditions should be
optimized before continuing further (see Section 8).
7.3. Negative control
It is recommended to add a no-template control to all
direct PCR assays. To monitor the efficiency of cleaning
the puncher, the cleaned sampling tool can be dipped
into the negative control sample. A second negative
control performed without dipping the puncher is
recommended to control other sources of contamination.
References
1. Demesure B. et al. (1995) Molecular Ecology 4:
129–131.
Technical support
EMEA: ts.molbio.eu@thermofisher.com
North America, Latin America & APAC: ts.molbio@thermofisher.com
NOTICE TO PURCHASER
• The purchase price of this product includes a limited, nontransferable
license under U.S. and foreign patents owned by BIO-RAD
Laboratories, Inc., to use this product. No other license under these
patents is conveyed expressly or by implication to the purchaser by the
purchase of this product.
• This product is sold under license from Affibody AB, Sweden.
8. Troubleshooting
No product at all or low yield
General
If the positive control with
purified DNA using your own
primers is not working:
• Optimize annealing
temperature.
• Make sure the cycling
protocol was performed as
recommended.
• Check primer design.
Direct protocol
If the positive control with
purified DNA and the Direct
PCR control reaction with
control primers are working, but
the actual samples yield no
product:
• Increase the PCR reaction
volume to 50 µL or use a
smaller sample (e.g. 0.35
mm punch).
• Increase the number of
cycles.
• Use dilution protocol for
amplification of large or
difficult samples and long
DNA fragments.
Dilution protocol
If the positive control with
purified DNA and the Direct
PCR control reaction with
control primers are working,
but the actual samples yield no
product:
• Dilute the supernatant
(from the sample treated
with Dilution Buffer) 1:10
and/or 1:100 with H
2
O/TE
buffer, and use 0.5 µL as a
template in PCR.
• Try both crushing and not
crushing the sample.
• Incubate the sample in
Dilution Buffer for 3 min
at room temperature and
use 0.5 µL as a template
(1:1 and 1:10 dilution) in a
20 µL reaction.
• Use smaller sample size or
increase the volume of
Dilution Buffer.
Non
-
specific products
-
High molecular weight smears
•
Make sure the extension
time used was not too long
(>20 s/kb).
• Reduce the total number of
cycles.
• Increase annealing
temperature or perform a
temperature gradient PCR.
•
Decrease primer
concentration.
• Make sure the cutting tools
were properly cleaned with
2% sodium hypochlorite.
Include a negative control.
Non
-
specific products
-
Low molecular weight discrete bands
•
Increase the annealing
temperature or perform a
temperature gradient PCR.
• Shorten extension time.
• Decrease primer
concentration.
•
Reduce the total number of
cycles.
• Design new primers.
• Make sure the cutting tools
were properly cleaned with
2% sodium hypochlorite.
Include a negative control.
PRODUCT USE LIMITATION
This product is developed, designed and sold exclusively for research
purposes and in vitro use only. The product was not tested for use in
diagnostics or for drug development, nor is it suitable for administration to
humans or animals. Please refer to www.thermoscientific.com/onebio for
Material Safety Data Sheet of the product.
© 2014 Thermo Fisher Scientific, Inc. All rights reserved. Whatman, FTA
and 903 are trademarks of GE Healthcare and its subsidiaries. All other
trademarks are the property of Thermo Fisher Scientific Inc. and its
subsidiaries.
